Go Back E.coli LexA repressor
Product Detail
| Cat # | 01-006 |
| Size | 100 ug |
| Price |
$1,120.00 |
| Downloads | |
E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As the result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced (1). LexA fused genes are used as baits in the experiments to detect the protein-protein interaction in the yeast two-hybrid method (2). The product is over-produced as a recombinant protein, and highly purified by several steps of chromatography. A single band is observed by SDS-PAGE at 23 kD.